|
Sartorius AG
incucyte zoom microscope software 2015a Incucyte Zoom Microscope Software 2015a, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/incucyte zoom microscope software 2015a/product/Sartorius AG Average 99 stars, based on 1 article reviews
incucyte zoom microscope software 2015a - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
Regent Instruments
winfolia pro 2015a software Winfolia Pro 2015a Software, supplied by Regent Instruments, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/winfolia pro 2015a software/product/Regent Instruments Average 86 stars, based on 1 article reviews
winfolia pro 2015a software - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
VERBI Software GmbH
maxqda 11 Maxqda 11, supplied by VERBI Software GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/maxqda 11/product/VERBI Software GmbH Average 90 stars, based on 1 article reviews
maxqda 11 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Carl Zeiss
zen lite 2012 software Zen Lite 2012 Software, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zen lite 2012 software/product/Carl Zeiss Average 97 stars, based on 1 article reviews
zen lite 2012 software - by Bioz Stars,
2026-05
97/100 stars
|
Buy from Supplier |
|
MathWorks Inc
image acquisition image processing toolboxes release 2015a  Image Acquisition Image Processing Toolboxes Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/image acquisition image processing toolboxes release 2015a/product/MathWorks Inc Average 96 stars, based on 1 article reviews
image acquisition image processing toolboxes release 2015a - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
Sony
vaio laptop model vpceh2j1e Vaio Laptop Model Vpceh2j1e, supplied by Sony, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vaio laptop model vpceh2j1e/product/Sony Average 90 stars, based on 1 article reviews
vaio laptop model vpceh2j1e - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
STATA Corporation
version 14 2 Version 14 2, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/version 14 2/product/STATA Corporation Average 99 stars, based on 1 article reviews
version 14 2 - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
extra sums-of-squares f-tests Extra Sums Of Squares F Tests, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/extra sums-of-squares f-tests/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
extra sums-of-squares f-tests - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Ridom GmbH
seqsphere+ software version 3.1 Seqsphere+ Software Version 3.1, supplied by Ridom GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/seqsphere+ software version 3.1/product/Ridom GmbH Average 90 stars, based on 1 article reviews
seqsphere+ software version 3.1 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
ANSYS inc
ansys software Ansys Software, supplied by ANSYS inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ansys software/product/ANSYS inc Average 90 stars, based on 1 article reviews
ansys software - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
GraphPad Software Inc
graphpad prism 8.0.2 Graphpad Prism 8.0.2, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graphpad prism 8.0.2/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graphpad prism 8.0.2 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
OriginLab corp
origin 2015a software Origin 2015a Software, supplied by OriginLab corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/origin 2015a software/product/OriginLab corp Average 90 stars, based on 1 article reviews
origin 2015a software - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell reports
Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion
doi: 10.1016/j.celrep.2019.09.045
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and
Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software